produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
A quick username checker to see if a username is available on a list of assorted websites.

A quick username checker to see if a username is available on a list of assorted websites.

Maddie 4 Jan 04, 2022
This is discord nitro code generator and checker made with python. This will generate nitro codes and checks if the code is valid or not. If code is valid then it will print the code leaving 2 lines and if not then it will print '*'.

Discord Nitro Generator And Checker ⚙️ Rᴜɴ Oɴ Rᴇᴘʟɪᴛ 🛠️ Lᴀɴɢᴜᴀɢᴇs Aɴᴅ Tᴏᴏʟs If you are taking code from this repository without a fork, then atleast

Vɪɴᴀʏᴀᴋ Pᴀɴᴅᴇʏ 37 Jan 07, 2023
Modest utility collection for development with AIOHTTP framework.

aiohttp-things Modest utility collection for development with AIOHTTP framework. Documentation https://aiohttp-things.readthedocs.io Installation Inst

Ruslan Ilyasovich Gilfanov 0 Dec 11, 2022
Plone Interface contracts, plus basic features and utilities

plone.base This package is the base package of the CMS Plone https://plone.org. It contains only interface contracts and basic features and utilitie

Plone Foundation 1 Oct 03, 2022
Shypan, a simple, easy to use, full-featured library written in Python.

Shypan, a simple, easy to use, full-featured library written in Python.

ShypanLib 4 Dec 08, 2021
Tool for generating Memory.scan() compatible instruction search patterns

scanpat Tool for generating Frida Memory.scan() compatible instruction search patterns. Powered by r2. Examples $ ./scanpat.py arm.ks:64 'sub sp, sp,

Ole André Vadla Ravnås 13 Sep 19, 2022
Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine.

Keval Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine. The user mode portion

42 Dec 17, 2022
Teleport Ur Logs with Love

Whatever you pipe into tull, will get a unique UUID and the data gets stored locally - accessible via a flask server with simple endpoints. You can use ngrok or localtunnel then to share it outside L

Lokendra Sharma 11 Jul 30, 2021
A utility that makes it easy to work with Python projects containing lots of packages, of which you only want to develop some.

Mixed development source packages on top of stable constraints using pip mxdev [mɪks dɛv] is a utility that makes it easy to work with Python projects

BlueDynamics Alliance 6 Jun 08, 2022
Create C bindings for python automatically with the help of libclang

Python C Import Dynamic library + header + ctypes = Module like object! Create C bindings for python automatically with the help of libclang. Examples

1 Jul 25, 2022
A morse code encoder and decoder utility.

morsedecode A morse code encoder and decoder utility. Installation Install it via pip: pip install morsedecode Alternatively, you can use pipx to run

Tushar Sadhwani 2 Dec 25, 2021
Conveniently measures the time of your loops, contexts and functions.

Conveniently measures the time of your loops, contexts and functions.

Maciej J Mikulski 79 Nov 15, 2022
The producer-consumer problem implemented with threads in Python

This was developed using a Python virtual environment, I would strongly recommend to do the same if you want to clone this repository. How to run this

Omar Beltran 1 Oct 30, 2021
Writing Alfred copy/paste scripts in Python

Writing Alfred copy/paste scripts in Python This repository shows how to create Alfred scripts in Python. It assumes that you using pyenv for Python v

Will Fitzgerald 2 Oct 26, 2021
A small utility that sorts your files.

FileSorter A small utility that sorts your files. TODO: Scan directory to find files(thanks @corruptmemry for this!) Split extensions to determine fil

2 Jun 16, 2022
Standard implementations of FedLab and its provided benchmarks.

FedLab-benchmarks This repo contains standard implementations of FedLab and its provided benchmarks. Currently, following algorithms or benchrmarks ar

SMILELab-FL 104 Dec 05, 2022
DUQ is a python package for working with physical Dimensions, Units, and Quantities.

DUQ is a python package for working with physical Dimensions, Units, and Quantities.

2 Nov 02, 2022
A string to hashtags module

A string to hashtags module

Fayas Noushad 4 Dec 01, 2021
Simple tool for creating changelogs

Description Simple utility for quickly generating changelogs, assuming your commits are ordered as they should be. This tool will simply log all lates

2 Jan 05, 2022
password generator

Password generator technologies used What is? It is Password generator How to Download? Download on releases Clone repo git clone https://github.com/m

1 Dec 16, 2021