Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

Related tags

File & Path UtilitiesGetTransTool
Overview

GetTransTool Package

There are four types of methods to extract longest transcript or longest CDS regeion with longest transcript from transcripts fasta file or GTF file.

  • 1.Extract longest transcript from gencode transcripts fasta file.

  • 2.Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

  • 3.Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

  • 4.Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

Install

$ pip install GetTransTool

Usage

1. get longest transcript from gencode transcripts fasta file:

help infomation:

$ GetLongestTransFromGencode -h
usage: GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans.fa

Get longest transcripts from gencode transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your transcripts file with ".gz" format. (gencode.vM28.transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans_gencode.fa
Your job is running, please wait...
Your job is done!
Running with 32.33 seconds!

there will be three files produced including name_changed.fa, longest_transcripts_info.csv, longest_trans_gencode.fa.

name_changed.fa:

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

longest_transcripts_info.csv:

this is the longest transcripts exon length information.

fullname,gene_name,translength
snoZ196_ENSMUSG00002074855.1_ENSMUST00020182568.1_35,snoZ196,35
snoZ159_ENSMUSG00002075734.1_ENSMUST00020182611.1_87,snoZ159,87
n-R5s93_ENSMUSG00000119639.1_ENSMUST00000240071.1_119,n-R5s93,119
...

longest_trans_gencode.fa:

this is the filtered longest transcript fasta file.

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

2. Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database:

help infomation:

$ GetLongestTransFromGTF -h
usage: GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans.fa

Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl/gencode)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 159.51 seconds!

there will be three files produced including longest_transcripts_info.csv, longest_trans.gtf, longest_trans_ensembl.fa.

longest_transcripts_info.csv:

,transcript_length,gene_name
snoZ196_ENSG00000281780_ENST00000625269_snoRNA,89,snoZ196
hsa-mir-423_ENSG00000266919_ENST00000586878_lncRNA,94,hsa-mir-423
hsa-mir-1253_ENSG00000272920_ENST00000609567_lncRNA,105,hsa-mir-1253
...

longest_trans.gtf:

this is the gtf information for the longest transcripts.

1	havana	gene	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
1	havana	transcript	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "basic"; transcript_support_level "1";
1	havana	exon	11869	12227	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "1"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002234944"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	12613	12721	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00003582793"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	13221	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "3"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002312635"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	gene	14404	29570	.	-	.	gene_id "ENSG00000227232"; gene_version "5"; gene_name "WASH7P"; gene_source "havana"; gene_biotype "unprocessed_pseudogene";

longest_trans_ensembl.fa:

>DDX11L1_ENSG00000223972_ENST00000456328_transcribed_unprocessed_pseudogene
GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTC
TCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGA
TGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTG
...

for ucsc:

$ GetLongestTransFromGTF --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_trans_ucsc.fa

3. Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

help infomation:

$ GetCDSLongestFromGencode -h
usage: GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your protein-coding transcripts file with ".gz" format. (gencode.vM28.pc_transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans_gencode.fa
Your job is running, please wait...
Your job is done! 
Running with 17.67 seconds!

there will be four files produced including name_changed.fa, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_gencode.fa.

name_changed.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_transcripts_info.csv:

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_trans_gencode.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

4. Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

help infomation:

$ GetCDSLongestFromGTF -h
usage: GetCDSLongestFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o cdslongestfile, --outfile cdslongestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGTF  --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 152.38 seconds!

there will be four files produced including CDS_longest_trans.gtf, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_ensembl.fa.

CDS_longest_trans.gtf:

1	ensembl_havana	gene	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
1	havana	transcript	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003812156"; exon_version "1"; tag "basic";
1	havana	exon	65520	65573	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813641"; exon_version "1"; tag "basic";
1	havana	CDS	65565	65573	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	start_codon	65565	65567	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	69037	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813949"; exon_version "1"; tag "basic";
1	havana	CDS	69037	70005	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	stop_codon	70006	70008	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65520	65564	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	three_prime_utr	70009	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	ensembl_havana	gene	450740	451678	.	-	.	gene_id "ENSG00000284733"; gene_version "2"; gene_name "OR4F29"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
1227,ZZZ3_ENSG00000036549_ENST00000370798,2468,486,ZZZ3
173,ZZZ3_ENSG00000036549_ENST00000433749,603,430,ZZZ3
...

longest_cds_transcripts_info.csv:

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
8883,ZZEF1_ENSG00000074755_ENST00000381638,11466,135,ZZEF1
1716,ZYX_ENSG00000159840_ENST00000322764,2228,80,ZYX
...

longest_cds_trans_gencode.fa:

>OR4F5_ENSG00000186092_ENST00000641515_61_1038_2618
CCCAGATCTCTTCAGTTTTTATGCCTCATTCTGTGAAAATTGCTGTAGTCTCTTCCAGTT
ATGAAGAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAAC
TCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTC
...

for ucsc:

$ GetCDSLongestFromGTF  --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_cds_trans_ensembl.fa

END

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

Owner
laojunjun
路漫漫其修远兮 吾将上下而求索
laojunjun
GitHub Repository
Various technical documentation, in electronically parseable format

a-pile-of-documentation Various technical documentation, in electronically parseable format. You will need Python 3 to run the scripts and programs in

Jonathan Campbell 2 Nov 20, 2022
Provides a convenient way to append numpy arrays to a file.

Provides a convenient way to append numpy arrays to a file. The NpendWriter and NpendReader classes are used to write and read numpy arrays respective

3 May 14, 2022
An universal file format tool kit. At present will handle the ico format problem.

An universal file format tool kit. At present will handle the ico format problem.

Sadam·Sadik 1 Dec 26, 2021
MetaMove is written in Python3 and aims at easing batch renaming operations based on file meta data.

MetaMove MetaMove is written in Python3 and aims at easing batch renaming operations based on file meta data. MetaMove abuses eval combined with f-str

Jan Philippi 2 Dec 28, 2021
Simple archive format designed for quickly reading some files without extracting the entire archive

Simple archive format designed for quickly reading some files without extracting the entire archive

Jarred Sumner 336 Dec 30, 2022
PaddingZip - a tool that you can craft a zip file that contains the padding characters between the file content.

PaddingZip - a tool that you can craft a zip file that contains the padding characters between the file content.

phithon 53 Nov 07, 2022
Simple Python File Manager

This script lets you automatically relocate files based on their extensions. Very useful from the downloads folder !

Aimé Risson 22 Dec 27, 2022
Get Your TXT File Length !.

TXTLen Get Your TXT File Length !. Hi 👋 , I'm Alireza A Python Developer Boy 🔭 I’m currently working on my C# projects 🌱 I’m currently Learning CSh

Alireza Hasanzadeh 1 Jan 06, 2022
🧹 Create symlinks for .m2ts files and classify them into directories in yyyy-mm format.

🧹 Create symlinks for .m2ts files and classify them into directories in yyyy-mm format.

Nep 2 Feb 07, 2022
Pure Python tools for reading and writing all TIFF IFDs, sub-IFDs, and tags.

Tiff Tools Pure Python tools for reading and writing all TIFF IFDs, sub-IFDs, and tags. Developed by Kitware, Inc. with funding from The National Canc

Digital Slide Archive 32 Dec 14, 2022
CSV To VCF (Multiples en un archivo)

CSV To VCF Convierte archivo CSV a Tarjeta VCF (varias en una) How to use En main.py debes reemplazar CONTACTOS.csv por tu archivo csv, y debes respet

Jorge Ivaldi 2 Jan 12, 2022
A file utility for accessing both local and remote files through a unified interface.

A file utility for accessing both local and remote files through a unified interface.

AI2 19 Nov 16, 2022
Convert CSV files into a SQLite database

csvs-to-sqlite Convert CSV files into a SQLite database. Browse and publish that SQLite database with Datasette. Basic usage: csvs-to-sqlite myfile.cs

Simon Willison 731 Dec 27, 2022
Find potentially sensitive files

find_files Find potentially sensitive files This script searchs for potentially sensitive files based off of file name or string contained in the file

4 Aug 20, 2022
Various converters to convert value sets from CSV to JSON, etc.

ValueSet Converters Tools for converting value sets in different formats. Such as converting extensional value sets in CSV format to JSON format able

Health Open Terminology Ecosystem 4 Sep 08, 2022
A simple file module for creating, editing and saving files.

A simple file module for creating, editing and saving files.

1 Nov 25, 2021
An object-oriented approach to Python file/directory operations.

Unipath An object-oriented approach to file/directory operations Version: 1.1 Home page: https://github.com/mikeorr/Unipath Docs: https://github.com/m

Mike Orr 506 Dec 29, 2022
Python script for converting figma produced SVG files into C++ JUCE framework source code

AutoJucer Python script for converting figma produced SVG files into C++ JUCE framework source code Watch the tutorial here! Getting Started Make some

SuperConductor 1 Nov 26, 2021
Small-File-Explorer - I coded a small file explorer with several options

Petit explorateur de fichier / Small file explorer Pour la première option (création de répertoire) / For the first option (creation of a directory) e

Xerox 1 Jan 03, 2022
A tool for batch processing large fasta files and accompanying metadata table to upload to repositories via API

Fasta Uploader A tool for batch processing large fasta files and accompanying metadata table to repositories via API The python fasta_uploader.py scri

Centre for Infectious Disease and One Health 1 Dec 09, 2021