Python codecs extension featuring CLI tools for encoding/decoding anything

Overview

CodExt Tweet

Encode/decode anything.

PyPi Read The Docs Build Status Coverage Status Python Versions Requirements Status Known Vulnerabilities DOI License

This library extends the native codecs library (namely for adding new custom encodings and character mappings) and provides a myriad of new encodings (static or parametrized, like rot or xor), hence its named combining CODecs EXTension.

$ pip install codext
Want to contribute a new codec ? Want to contribute a new macro ?
Check the documentation first
Then PR your new codec
PR your updated version of macros.json

πŸ” Demonstrations

Using CodExt from the command line

Using base tools from the command line

Using the debase command line tool

πŸ’» Usage (main CLI tool) Tweet on codext

$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA

$ echo -en "test" | codext encode morse
- . ... -

$ echo -en "test" | codext encode braille
β žβ ‘β Žβ ž

$ echo -en "test" | codext encode base100
πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«

Chaining codecs

$ echo -en "Test string" | codext encode reverse
gnirts tseT

$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -

$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC

$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103

$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string

Using macros

$ codext add-macro my-encoding-chain gzip base63 lzma base64

$ codext list macros
example-macro, my-encoding-chain

$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==

$ codext remove-macro my-encoding-chain

$ codext list macros
example-macro

πŸ’» Usage (base CLI tool) Tweet on debase

$ echo "Test string !" | base122
*.7!ft9οΏ½-f9Γ‚

$ echo "Test string !" | base91 
"ONK;WDZM%Z%xE7L

$ echo "Test string !" | base91 | base85
B2P|BJ6A+nO(j|-cttl%

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr
QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d
Test string !
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | debase -m 3
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | debase -f Test
Test string !

πŸ’» Usage (Python)

Getting the list of available codecs:

>> codext.encode("this is a test", "base58-ripple") 'jo9rA2LQwr44eBmZK7E' >>> codext.encode("this is a test", "base58-url") 'JN91Wzkpa1nnDbLyjtf' >>> codecs.encode("this is a test", "base100") 'πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«' >>> codecs.decode("πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«", "base100") 'this is a test' >>> for i in range(8): print(codext.encode("this is a test", "dna-%d" % (i + 1))) GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT >>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1") 'this is a test' >>> codecs.encode("this is a test", "morse") '- .... .. ... / .. ... / .- / - . ... -' >>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse") 'this is a test' >>> with open("morse.txt", 'w', encoding="morse") as f: f.write("this is a test") 14 >>> with open("morse.txt",encoding="morse") as f: f.read() 'this is a test' >>> codext.decode(""" = X : x n r y Y y p a ` n | a o h ` g o z """, "whitespace-after+before") 'CSC{not_so_invisible}' >>> print(codext.encode("An example test string", "baudot-tape")) ***.** . * ***.* * . .* * .* . * ** .* ***.** ** .** .* * . * *. * .* * *. * *. * * . * *. * *. * ***. *.* ***.* * .* ">
>>> import codext

>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']

>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'

>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'

>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'

>>> codecs.encode("this is a test", "base100")
'πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«'

>>> codecs.decode("πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«", "base100")
'this is a test'

>>> for i in range(8):
        print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'

>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'

>>> with open("morse.txt", 'w', encoding="morse") as f:
	f.write("this is a test")
14

>>> with open("morse.txt",encoding="morse") as f:
	f.read()
'this is a test'

>>> codext.decode("""
      =            
              X         
   :            
      x         
  n  
    r 
        y   
      Y            
              y        
     p    
         a       
 `          
            n            
          |    
  a          
o    
       h        
          `            
          g               
           o 
   z      """, "whitespace-after+before")
'CSC{not_so_invisible}'

>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
   . *
***.* 
*  .  
   .* 
*  .* 
   . *
** .* 
***.**
** .**
   .* 
*  .  
* *. *
   .* 
* *.  
* *. *
*  .  
* *.  
* *. *
***.  
  *.* 
***.* 
 * .* 

πŸ“ƒ List of codecs

BaseXX

  • ascii85: classical ASCII85 (Python3 only)
  • baseN: see base encodings (incl base32, 36, 45, 58, 62, 63, 64, 91, 100, 122)
  • base-genericN: see base encodings ; supports any possible base

Binary

  • baudot: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
  • baudot-spaced: variant of baudot ; groups of 5 bits are whitespace-separated
  • baudot-tape: variant of baudot ; outputs a string that looks like a perforated tape
  • bcd: Binary Coded Decimal, encodes characters from their (zero-left-padded) ordinals
  • bcd-extended0: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 0000
  • bcd-extended1: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 1111
  • excess3: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
  • gray: aka reflected binary code
  • manchester: XORes each bit of the input with 01
  • manchester-inverted: variant of manchester ; XORes each bit of the input with 10
  • rotateN: rotates characters by the specified number of bits (N belongs to [1, 7] ; Python 3 only)

Common

  • a1z26: keeps words whitespace-separated and uses a custom character separator
  • cases: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
  • dummy: set of simple encodings (including reverse and word-reverse)
  • octal: dummy octal conversion (converts to 3-digits groups)
  • octal-spaced: variant of octal ; dummy octal conversion, handling whitespace separators
  • ordinal: dummy character ordinals conversion (converts to 3-digits groups)
  • ordinal-spaced: variant of ordinal ; dummy character ordinals conversion, handling whitespace separators

Compression

  • gzip: standard Gzip compression/decompression
  • lz77: compresses the given data with the algorithm of Lempel and Ziv of 1977
  • lz78: compresses the given data with the algorithm of Lempel and Ziv of 1978
  • pkzip_deflate: standard Zip-deflate compression/decompression
  • pkzip_bzip2: standard BZip2 compression/decompression
  • pkzip_lzma: standard LZMA compression/decompression

Cryptography

  • affine: aka Affine Cipher
  • atbash: aka Atbash Cipher
  • bacon: aka Baconian Cipher
  • barbie-N: aka Barbie Typewriter (N belongs to [1, 4])
  • citrix: aka Citrix CTX1 passord encoding
  • rotN: aka Caesar cipher (N belongs to [1,25])
  • scytaleN: encrypts using the number of letters on the rod (N belongs to [1,[)
  • shiftN: shift ordinals (N belongs to [1,255])
  • xorN: XOR with a single byte (N belongs to [1,255])

Languages

  • braille: well-known braille language (Python 3 only)
  • ipsum: aka lorem ipsum
  • leetspeak: based on minimalistic elite speaking rules
  • morse: uses whitespace as a separator
  • navajo: only handles letters (not full words from the Navajo dictionary)
  • radio: aka NATO or radio phonetic alphabet
  • southpark: converts letters to Kenny's language from Southpark (whitespace is also handled)
  • southpark-icase: case insensitive variant of southpark
  • tomtom: similar to morse, using slashes and backslashes

Others

  • dna: implements the 8 rules of DNA sequences (N belongs to [1,8])
  • html: implements entities according to this reference
  • letter-indices: encodes consonants and/or vowels with their corresponding indices
  • markdown: unidirectional encoding from Markdown to HTML
  • url: aka URL encoding

Steganography

  • klopf: aka Klopf code ; Polybius square with trivial alphabetical distribution
  • resistor: aka resistor color codes
  • sms: also called T9 code ; uses "-" as a separator for encoding, "-" or "_" or whitespace for decoding
  • whitespace: replaces bits with whitespaces and tabs
  • whitespace_after_before: variant of whitespace ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "whitespace+2*after-3*before")

πŸ‘ Supporters

Stargazers repo roster for @dhondta/python-codext

Forkers repo roster for @dhondta/python-codext

Back to top

Comments
  • using Codext guess / Codext rank gives an error

    using Codext guess / Codext rank gives an error

    When I run it on linux and try to use "codext guess" or "codext rank" I get an error message saying:

    # echo "3yZe7d" | codext rank
    Traceback (most recent call last):
      File "/usr/local/bin/codext", line 8, in <module>
        sys.exit(main())
      File "/usr/local/lib/python3.9/dist-packages/codext/__init__.py", line 184, in main
        args.include, args.exclude = __format_list(args.include), __format_list(args.exclude, False)
    AttributeError: 'Namespace' object has no attribute 'include'
    
    opened by GitSunburn 1
  • UU decoding raises an exception in some cases

    UU decoding raises an exception in some cases

    # cat raw.txt 
    1Oh6axLwfecHErbVpRbtNj8t5JACsSQrofdnnMdQtBmoU8cQj6EyLcVRsQLz1MyWfXbqQDIc9wGyyBuH7uV95lBVpFGn3syGIw0IVLx8wJr4ABsIH9Q71hBH4AvIgljx7XnfjfmafahBNrPMDkK3dsJF0r41nzyMnOf7l36NcllAOgRLoB6Qh0APotZu6plYpkSiRCAkDKowOFm0mybKp336TAJe4JiDecD9hNbl5fBDLkGNYhmSkzOQzLBH1aPumW4o
    
    # codext -i raw.txt decode base62
    begin 666 <data>
    M'XL( /H^)V("__-)SBB-<O7*+#;,K8PL\/ H\C#UR2LP= H)[email protected]\*"[email protected]
    M\"T-\*@(#\]V\<A,*R^W\"@I,W9Q-,LU\8XR=$XM*TYR3PG,2G)+RO P#_'.
    ?"LRJS#)US0X(KPJH<[email protected](<TGR  #3A(K<90      
     
    end
    
    # codext -i raw.txt decode base62 | codext decode UU
    Traceback (most recent call last):
      File "/usr/lib/python3.8/encodings/uu_codec.py", line 58, in uu_decode
        data = binascii.a2b_uu(s)
    binascii.Error: Illegal char
    
    During handling of the above exception, another exception occurred:
    
    Traceback (most recent call last):
      File "/home/jeane/.local/bin/codext", line 8, in <module>
        sys.exit(main())
      File "/home/jeane/.local/lib/python3.8/site-packages/codext/__init__.py", line 124, in main
        c = getattr(codecs, ["encode", "decode"][args.command == "decode"])(c, encoding, args.errors)
      File "/home/jeane/.local/lib/python3.8/site-packages/codext/__common__.py", line 691, in decode
        return lookup(encoding).decode(obj, errors)[0]
      File "/usr/lib/python3.8/encodings/uu_codec.py", line 62, in uu_decode
        data = binascii.a2b_uu(s[:nbytes])
    binascii.Error: Illegal char
    
    opened by RomainJennes 1
  • Implement Rail Fence Cipher

    Implement Rail Fence Cipher

    Tests pass.

    RegEx might need a fix : rail-5-3- is recognized as a valid codec (ending dash is too much). Only rail-5-3 or rail-5-3-up should be recognized. Couldn't manage to get that right.

    When encoding, there might be trailing whitespaces (which is normal), but users might forget one when copy/pasting. I left them invisible to ease the integration with other tools.

    opened by smarbal 0
  • Add tap/knock language

    Add tap/knock language

    Tap encoding and decoding is implemented and added to the documentation. Couldn't make it work with add_map() due to problems with letter and word separations (single space/double space). Did my own encoding/decoding functions instead.

    opened by smarbal 0
  • [Snyk] Security upgrade markdown2 from 2.3.10 to 2.4.0

    [Snyk] Security upgrade markdown2 from 2.3.10 to 2.4.0

    Snyk has created this PR to fix one or more vulnerable packages in the `pip` dependencies of this project.

    Changes included in this PR

    • Changes to the following files to upgrade the vulnerable dependencies to a fixed version:
      • requirements.txt

    Vulnerabilities that will be fixed

    By pinning:

    Severity | Priority Score (*) | Issue | Upgrade | Breaking Change | Exploit Maturity :-------------------------:|-------------------------|:-------------------------|:-------------------------|:-------------------------|:------------------------- high severity | 768/1000
    Why? Proof of Concept exploit, Recently disclosed, Has a fix available, CVSS 7.5 | Regular Expression Denial of Service (ReDoS)
    SNYK-PYTHON-MARKDOWN2-1063233 | markdown2:
    2.3.10 -> 2.4.0
    | No | Proof of Concept

    (*) Note that the real score may have changed since the PR was raised.

    Some vulnerabilities couldn't be fully fixed and so Snyk will still find them when the project is tested again. This may be because the vulnerability existed within more than one direct dependency, but not all of the effected dependencies could be upgraded.

    Check the changes in this PR to ensure they won't cause issues with your project.


    Note: You are seeing this because you or someone else with access to this repository has authorized Snyk to open fix PRs.

    For more information: 🧐 View latest project report

    πŸ›  Adjust project settings

    πŸ“š Read more about Snyk's upgrade and patch logic

    opened by dhondta 0
  • pip 22.3 / python 3.10 warning on install

    pip 22.3 / python 3.10 warning on install

    Looks like there's a warning on the installation method via pip:

    pip install codext         
    Collecting codext
      Downloading codext-1.14.0.tar.gz (116 kB)
         ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 116.2/116.2 kB 1.7 MB/s eta 0:00:00
      Preparing metadata (setup.py) ... done
    Requirement already satisfied: six in ./venv/lib/python3.10/site-packages (from codext) (1.16.0)
    Collecting markdown2>=2.4.0
      Downloading markdown2-2.4.6-py2.py3-none-any.whl (37 kB)
    Installing collected packages: markdown2, codext
      DEPRECATION: codext is being installed using the legacy 'setup.py install' method, because it does not have a 'pyproject.toml' and the 'wheel' package is not installed. pip 23.1 will enforce this behaviour change. A possible replacement is to enable the '--use-pep517' option. Discussion can be found at https://github.com/pypa/pip/issues/8559
      Running setup.py install for codext ... done
    Successfully installed codext-1.14.0 markdown2-2.4.6
    
    opened by mikeatlas 0
Releases(1.10.1)
Owner
Alex
I'm a security professional, passionate about programming (especially Python) and cyber security.
Alex
ForX - get forex quotes from the terminal

A command line tool for checking exchange rates between currencies, both crypto and fiat.

Gabe Banks 52 Dec 10, 2022
Project scoped command execution to just do your work

Judoka is a command line utility that lets you define project scoped commands and call them through their alias. It lets you just do (= judo) your work.

Eelke van den Bos 2 Dec 17, 2021
stonky is a simple command line dashboard for monitoring stocks.

stonky is a simple command line dashboard for monitoring stocks.

Jessy Williams 228 Dec 14, 2022
WA Terminal is a CLI application that allows us to login and send message with WhatsApp with a single command.

WA Terminal is a CLI application that allows us to login and send message with WhatsApp with a single command.

Aziz Fikri 15 Apr 15, 2022
A Terminal UI for Discord

ToastCord ToastCord is a Discord Terminal UI. At the moment you can only look at Direct messages. TODO: - Add support for guilds - Message sending sup

toast 82 Dec 18, 2022
Investing library and command-line interface inspired by the Bogleheads philosophy

Lakshmi (Screenshot of the lak command in action) Background This project is inspired by Bogleheads forum. Bogleheads focus on a simple but powerful p

Sarvjeet Singh 108 Dec 26, 2022
PyDropper - pick colors everywhere

PyDropper - pick colors everywhere Downloads Settings PyDropper is an eyedropper

Herman Brunberg 2 Jan 04, 2022
Task-manager-CLI with Priority Modification

Task-manager-CLI with Priority Modification The functions for the app have been written in task.py file. 1. Install Node.js This project requires Node

1 Jan 21, 2022
Proman is a simple tool for managing projects through cli.

proman proman is a project manager. It helps you manage your projects from a terminal. The features are listed below. Installation Step 1: Download or

Arjun Somvanshi 2 Dec 06, 2021
A simple python implementation of a reverse shell

llehs A python implementation of a reverse shell. Note for contributors The project is open for contributions and is hacktoberfest registered! llehs u

Archisman Ghosh 2 Jul 05, 2022
AutoSub is a CLI application to generate subtitle files (.srt, .vtt, and .txt transcript) for any video file using Mozilla DeepSpeech.

AutoSub About Motivation Installation Docker How-to example How it works TO-DO Contributing References About AutoSub is a CLI application to generate

Abhiroop Talasila 414 Jan 06, 2023
A python library for parsing multiple types of config files, envvars & command line arguments that takes the headache out of setting app configurations.

parse_it A python library for parsing multiple types of config files, envvars and command line arguments that takes the headache out of setting app co

Naor Livne 97 Oct 22, 2022
A command line tool to query source code from your current Python env

wxc wxc (pronounced "which") allows you to inspect source code in your Python environment from the command line. It is based on the inspect module fro

ClΓ©ment Robert 13 Nov 08, 2022
Fetch is use to get information about anything on the shell using Wikipedia.

Fetch Search wikipedia article on command line [Why This?] [Support the Project] [Installation] [Configuration] Why this? Fetch helps you to quickly l

Yash Singh 340 Dec 18, 2022
An interactive cheatsheet tool for the command-line

navi An interactive cheatsheet tool for the command-line. navi allows you to browse through cheatsheets (that you may write yourself or download from

Denis Isidoro 12.2k Dec 31, 2022
A CLI tool for searching and watching videos on youtube with no spyware and MPV and yt-dlp

A CLI tool for searching and watching videos on youtube with no spyware and MPV and yt-dlp

TruncatedDinosour 3 Feb 22, 2022
CLabel is a terminal-based cluster labeling tool that allows you to explore text data interactively and label clusters based on reviewing that data.

CLabel is a terminal-based cluster labeling tool that allows you to explore text data interactively and label clusters based on reviewing that

Peter Baumgartner 29 Aug 09, 2022
Another (unofficial) Qt CLI Installer on multi-platforms

Another Qt installer(aqt) Release: Documentation: Test status: and Coverage: This is a utility alternative to the official graphical Qt installer, for

Hiroshi Miura 528 Jan 02, 2023
Logic-Sim - A clone of 'Digital Logic Sim' from Sebastian Lague

Logic Simulator This is a clone of 'Digital Logic Sim' from Sebastian Lague. But

Ethan 1 Feb 01, 2022
Use case: quick JSON processing/restructuring with jq without terminal

alfred-jq Alfred workflow to conveniently process JQ on clipboard based on a jq query Also available at: packal/jq Use case: quick JSON processing/res

T on Meta Mode 5 Sep 30, 2022